Review



primary human umbilical vein endothelial cells huvec  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC primary human umbilical vein endothelial cells huvec
    Primary Human Umbilical Vein Endothelial Cells Huvec, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 4947 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primary+umbilical+vein+endothelial+cells%3B+normal%2C+human/Primary+Umbilical+Vein+Endothelial+Cells%3B+Normal%2C+Human/pm42321469-533-0-12
    Average 99 stars, based on 4947 article reviews
    primary human umbilical vein endothelial cells huvec - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Cell Culture:

    Article Title: Circulating cell type senescence signatures track distinct dimensions of health status and trajectories in human longitudinal cohorts.
    Article Snippet: .. Cell culture, senescence induction and validation All cell types from the SenCat are of human origin, and include WI-38 lung fibroblasts (obtained from the NIGMS Human Genetic Cell Repository, Coriell Institute for Medical Research; repository ID AG06814-N), BJ skin fibroblasts (ATCC, CRL-2522), HSAEC lung epithelial cells (ATCC, PCS-301-010, HEKn epidermal skin keratinocytes (ATCC, PCS-200-010), HCAEC coronary artery endothelial cells (LifeLine Cell Technology, FC-0032), HUVEC umbilical vein endothelial cells (ATCC, PCS-100-010), HVSMC coronary artery smooth muscle cells (LifeLine Cell Technology, FC-0031), HSKM skeletal myoblasts (Gibco, A12555), PBMC peripheral blood mononuclear cells (ATCC, PCS-800-011), PreAdipo subcutaneous preadipocytes (ATCC, PCS-210-010), NHO osteoblasts (Lonza, CC2538), NHA astrocytes (Lonza, CC-2565), HEMn melanocytes (ATCC, PCS-200-012), and HREC renal epithelial cells. ..

    Article Title: A fatty acid amide activates myeloid cells and improves neurovascular outcomes in retinal degeneration.
    Article Snippet: HEK293T cell line (CRL-3216) was purchased from ATCC and cultured with Dulbecco's Modified Eagle's Medium (DMEM, 30-2002 TM, ATCC). .. Primary Human Umbilical Vein Endothelial Cells (HUVEC) (PCS-100-010 TM) were purchased from ATCC and cultured with Vascular Cell Basal Medium (PCS-100-030) with Endothelial Cell Growth Kit-VEGF (PCS-100-041). .. Human Choroidal Endothelial Cells (36052-03) were purchased from Celprogen and cultured with Human Choroidal Endothelial Cells Complete Growth Media with Serum (M36052-03S).

    Article Title: SenCat: Cataloging human cell senescence through multi-omic profiling of multiple senescent primary cell types.
    Article Snippet: HCAEC coronary artery endothelial cells (LifeLine Cell Technology, FC-0032) were cultured in VascuLife EnGS Endothelial Medium Complete Kit (LifeLine). .. HUVEC umbilical vein endothelial cells (ATCC, PCS-100-010) were cultured in Vascular Cell Basal Medium plus Endothelial Cell Growth Kit-BBE (ATCC). .. BMMSC bone marrow mesenchymal cells (ATCC, PCS-500-012) were cultured in Mesenchymal Stem Cell Basal Medium for Adipose, Umbilical and Bone Marrow-derived MSCs plus Mesenchymal Stem Cell Growth Kit for Bone Marrow-derived MSCs (ATCC).

    Article Title: FUNDC1-Associated Regulation of Mitochondrial Function Is Crucial for Preventing Endothelial Injury in Hyperglycemia.
    Article Snippet: .. Human umbilical vein endothelial cells were purchased from ATCC and cultured with an EGM-2 bullet kit system (#CC4147, Lonza) containing endothelial basal medium 2 (#CC3156, Lonza), 5% fetal bovine serum, human vascular endothelial growth factor, human basic fibroblast growth factor, human epidermal growth factor, human insulin-like growth factor-1, and ascorbic acid. ..

    Biomarker Discovery:

    Article Title: Circulating cell type senescence signatures track distinct dimensions of health status and trajectories in human longitudinal cohorts.
    Article Snippet: .. Cell culture, senescence induction and validation All cell types from the SenCat are of human origin, and include WI-38 lung fibroblasts (obtained from the NIGMS Human Genetic Cell Repository, Coriell Institute for Medical Research; repository ID AG06814-N), BJ skin fibroblasts (ATCC, CRL-2522), HSAEC lung epithelial cells (ATCC, PCS-301-010, HEKn epidermal skin keratinocytes (ATCC, PCS-200-010), HCAEC coronary artery endothelial cells (LifeLine Cell Technology, FC-0032), HUVEC umbilical vein endothelial cells (ATCC, PCS-100-010), HVSMC coronary artery smooth muscle cells (LifeLine Cell Technology, FC-0031), HSKM skeletal myoblasts (Gibco, A12555), PBMC peripheral blood mononuclear cells (ATCC, PCS-800-011), PreAdipo subcutaneous preadipocytes (ATCC, PCS-210-010), NHO osteoblasts (Lonza, CC2538), NHA astrocytes (Lonza, CC-2565), HEMn melanocytes (ATCC, PCS-200-012), and HREC renal epithelial cells. ..

    In Vitro:

    Article Title: Hyperadhesive von Willebrand Factor Contributes to Pathogenesis of Preeclampsia
    Article Snippet: .. Cells In Vitro We tested pcEVs for interaction with human umbilical vein endothelial cells (HUVECs; ATCC) using 3 complementary D ow nloaded from http://ahajournals.org by on June 16, 2026 OR IG IN AL R ES EA RC H - V B ..

    Protease Inhibitor:

    Article Title: Mapping cell type-resolved transcriptomic profiles to patient survival in pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GAPDH Proteintech Cat# 60004-1-Ig; RRID:AB_2107436 PLOD2 Abcam Cat# ab313765 Cytokeratin 19 Aifang Cat# AFRM0054 CD31 Abcam Cat# ab281583; RRID:AB_3096925 Fibronectin Proteintech Cat# 66042-1-Ig; RRID:AB_11182385 S100A2 Proteintech Cat# 15454-1-AP; RRID:AB_3669209 GATA6 Proteintech Cat# 55435-1-AP; RRID:AB_11182815 Paxillin Proteintech Cat# 10029-1-Ig; RRID:AB_513929 Integrin β1 Aifang Cat# AFRM0070 alpha smooth muscle Abcam Cat# ab7817; RRID:AB_262054 FAP Proteintech Cat# 11779-1-AP; RRID:AB_3669133 DUSP6 Proteintech Cat# 26071-1-AP; RRID:AB_3669521 ANGPTL4 Proteintech Cat# 18374-1-AP; RRID:AB_2878539 NDRG1 Proteintech Cat# 26902-1-AP; RRID:AB_2880676 CD45 Abcam Cat# ab281586; RRID:AB_3697165 MCTP2 Proteintech Cat# 17578-1-AP; RRID:AB_2143118 CD3 Abcam Cat# ab16669; RRID:AB_443425 CD68 Abcam Cat# ab283654; RRID:AB_2922954 SYN Proteintech Cat# 17785-1-AP; RRID:AB_2271365 IGF1R Proteintech Cat# 20254-1-AP; RRID:AB_10667455 PPP2R2C Proteintech Cat# 12747-1-AP; RRID:AB_2170099 hCD45 BioLegend Cat# 304008; RRID:AB_314396 mCD45 BioLegend Cat# 103112; RRID:AB_312977 HLA-G Proteintech Cat# 66447-1-Ig anti-Myc-Tag Cell Signaling Technology Cat# 2278; RRID: AB_490778 anti-FLAG Cell Signaling Technology Cat# 14793; RRID: AB_2572291 anti-HA Abcam Cat #ab9110, RRID: AB_307019 Biological samples Human pancreatic cancer tissues This study N/A Patient-derived xenografts This study N/A Chemicals, peptides, and recombinant proteins PROTAC-G3 This study N/A Activin A MedChemExpress Cat# HY-P70311 MG-132 MedChemExpress Cat# HY-13259 Latrunculin A Abcam Cat# ab144290 KP-457 MedChemExpress Cat# HY-110397 Cycloheximide MedChemExpress Cat# HY-12320 (S)-ACE-OH MedChemExpress Cat# HY169325 OVA Peptide MedChemExpress Cat# HY-P1489 Recombinant Streptococcus pyogenes CRISPR-Cas9 Protein (His Tag) SinoBiological Cat: 40572-A08B (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–16.e1–e11, August 10, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays poly-L-lysine MedChemExpress Cat# HY-126437K Optimal Cutting Temperature (OCT) compound Solarbio Cat# I7830 Protease inhibitor cocktail Proteintech Cat# PR20032 HypoxyprobeTM-1 Natural Pharmacia International Cat# HP3-100Kit P3 Primary Cell 4D-Nucleofector X Unit Reagent Kit L LONZA LONZA-V4XP-3024 IFN-γ ELISpot Kit Dayo Cat#2210005 DAPI Dihydrochloride Proteintech 28718-90-3 Deposited data snRNA-seq data (human PDAC tissues) This study National Omics Data Encyclopedia, OEP00006497 RNA-seq data (cell lines) This study National Omics Data Encyclopedia, OEZ00021631 Xenium 5K data (human PDAC tissues) This study National Omics Data Encyclopedia, OEZ00021630 snRNA-seq data (human PDAC tissues with neoadjuvant treatment) Hwang et al.11 GSE202051 scRNA-seq data (human PDAC tissues, #1) Steele et al. GSE155698 scRNA-seq data (human PDAC tissues, #2) Peng et al.12 CRA001160 scRNA-seq data (human PDAC tissues, #3) Lin et al. GSE154778 Experimental models: Cell lines MIA PaCa-2 American Type Culture Collection CRL-1420 CFPAC-1 American Type Culture Collection CRL-1918 SW1990 American Type Culture Collection CRL-2172 PANC-1 American Type Culture Collection CRL-1469 αTC1-6 American Type Culture Collection CRL-2934 THP-1 American Type Culture Collection TIB-202 HUVEC American Type Culture Collection PCS-100-013 HPDE6-C7 Anwei-sci Cell Center AW-CH0777 KPC-0116 FUSCC https://doi.org/10.1016/j. xcrm.2023.101234 Patient-derived CAFs FUSCC https://doi.org/10.1016/j. csbj.2024.04.021. .. Oligonucleotides siRNA targeting human PLOD2, si#1: GGAACACUAUGCUGAUCAAtt GeneAdv N/A siRNA targeting human PLOD2, si#2: GGUCCUUGGUICAAGGAGAAtt GeneAdv N/A siRNA targeting mouse PLOD2, si#2: CGAAGGACUUCCUGUUAAATT GeneAdv N/A sg-PLOD2-1: AATGTAGAAGCATCATGATG Tsingke Biotech N/A sg-TRIM21-3 TCATCTCAGAGCTAGATCGA Tsingke Biotech N/A (Continued on next page) ll OPEN ACCESS Article e2 Cancer Cell 44, 1–16.e1–e11, August 10, 2026

    Enzyme-linked Immunospot:

    Article Title: Mapping cell type-resolved transcriptomic profiles to patient survival in pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GAPDH Proteintech Cat# 60004-1-Ig; RRID:AB_2107436 PLOD2 Abcam Cat# ab313765 Cytokeratin 19 Aifang Cat# AFRM0054 CD31 Abcam Cat# ab281583; RRID:AB_3096925 Fibronectin Proteintech Cat# 66042-1-Ig; RRID:AB_11182385 S100A2 Proteintech Cat# 15454-1-AP; RRID:AB_3669209 GATA6 Proteintech Cat# 55435-1-AP; RRID:AB_11182815 Paxillin Proteintech Cat# 10029-1-Ig; RRID:AB_513929 Integrin β1 Aifang Cat# AFRM0070 alpha smooth muscle Abcam Cat# ab7817; RRID:AB_262054 FAP Proteintech Cat# 11779-1-AP; RRID:AB_3669133 DUSP6 Proteintech Cat# 26071-1-AP; RRID:AB_3669521 ANGPTL4 Proteintech Cat# 18374-1-AP; RRID:AB_2878539 NDRG1 Proteintech Cat# 26902-1-AP; RRID:AB_2880676 CD45 Abcam Cat# ab281586; RRID:AB_3697165 MCTP2 Proteintech Cat# 17578-1-AP; RRID:AB_2143118 CD3 Abcam Cat# ab16669; RRID:AB_443425 CD68 Abcam Cat# ab283654; RRID:AB_2922954 SYN Proteintech Cat# 17785-1-AP; RRID:AB_2271365 IGF1R Proteintech Cat# 20254-1-AP; RRID:AB_10667455 PPP2R2C Proteintech Cat# 12747-1-AP; RRID:AB_2170099 hCD45 BioLegend Cat# 304008; RRID:AB_314396 mCD45 BioLegend Cat# 103112; RRID:AB_312977 HLA-G Proteintech Cat# 66447-1-Ig anti-Myc-Tag Cell Signaling Technology Cat# 2278; RRID: AB_490778 anti-FLAG Cell Signaling Technology Cat# 14793; RRID: AB_2572291 anti-HA Abcam Cat #ab9110, RRID: AB_307019 Biological samples Human pancreatic cancer tissues This study N/A Patient-derived xenografts This study N/A Chemicals, peptides, and recombinant proteins PROTAC-G3 This study N/A Activin A MedChemExpress Cat# HY-P70311 MG-132 MedChemExpress Cat# HY-13259 Latrunculin A Abcam Cat# ab144290 KP-457 MedChemExpress Cat# HY-110397 Cycloheximide MedChemExpress Cat# HY-12320 (S)-ACE-OH MedChemExpress Cat# HY169325 OVA Peptide MedChemExpress Cat# HY-P1489 Recombinant Streptococcus pyogenes CRISPR-Cas9 Protein (His Tag) SinoBiological Cat: 40572-A08B (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–16.e1–e11, August 10, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays poly-L-lysine MedChemExpress Cat# HY-126437K Optimal Cutting Temperature (OCT) compound Solarbio Cat# I7830 Protease inhibitor cocktail Proteintech Cat# PR20032 HypoxyprobeTM-1 Natural Pharmacia International Cat# HP3-100Kit P3 Primary Cell 4D-Nucleofector X Unit Reagent Kit L LONZA LONZA-V4XP-3024 IFN-γ ELISpot Kit Dayo Cat#2210005 DAPI Dihydrochloride Proteintech 28718-90-3 Deposited data snRNA-seq data (human PDAC tissues) This study National Omics Data Encyclopedia, OEP00006497 RNA-seq data (cell lines) This study National Omics Data Encyclopedia, OEZ00021631 Xenium 5K data (human PDAC tissues) This study National Omics Data Encyclopedia, OEZ00021630 snRNA-seq data (human PDAC tissues with neoadjuvant treatment) Hwang et al.11 GSE202051 scRNA-seq data (human PDAC tissues, #1) Steele et al. GSE155698 scRNA-seq data (human PDAC tissues, #2) Peng et al.12 CRA001160 scRNA-seq data (human PDAC tissues, #3) Lin et al. GSE154778 Experimental models: Cell lines MIA PaCa-2 American Type Culture Collection CRL-1420 CFPAC-1 American Type Culture Collection CRL-1918 SW1990 American Type Culture Collection CRL-2172 PANC-1 American Type Culture Collection CRL-1469 αTC1-6 American Type Culture Collection CRL-2934 THP-1 American Type Culture Collection TIB-202 HUVEC American Type Culture Collection PCS-100-013 HPDE6-C7 Anwei-sci Cell Center AW-CH0777 KPC-0116 FUSCC https://doi.org/10.1016/j. xcrm.2023.101234 Patient-derived CAFs FUSCC https://doi.org/10.1016/j. csbj.2024.04.021. .. Oligonucleotides siRNA targeting human PLOD2, si#1: GGAACACUAUGCUGAUCAAtt GeneAdv N/A siRNA targeting human PLOD2, si#2: GGUCCUUGGUICAAGGAGAAtt GeneAdv N/A siRNA targeting mouse PLOD2, si#2: CGAAGGACUUCCUGUUAAATT GeneAdv N/A sg-PLOD2-1: AATGTAGAAGCATCATGATG Tsingke Biotech N/A sg-TRIM21-3 TCATCTCAGAGCTAGATCGA Tsingke Biotech N/A (Continued on next page) ll OPEN ACCESS Article e2 Cancer Cell 44, 1–16.e1–e11, August 10, 2026

    RNA Sequencing:

    Article Title: Mapping cell type-resolved transcriptomic profiles to patient survival in pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GAPDH Proteintech Cat# 60004-1-Ig; RRID:AB_2107436 PLOD2 Abcam Cat# ab313765 Cytokeratin 19 Aifang Cat# AFRM0054 CD31 Abcam Cat# ab281583; RRID:AB_3096925 Fibronectin Proteintech Cat# 66042-1-Ig; RRID:AB_11182385 S100A2 Proteintech Cat# 15454-1-AP; RRID:AB_3669209 GATA6 Proteintech Cat# 55435-1-AP; RRID:AB_11182815 Paxillin Proteintech Cat# 10029-1-Ig; RRID:AB_513929 Integrin β1 Aifang Cat# AFRM0070 alpha smooth muscle Abcam Cat# ab7817; RRID:AB_262054 FAP Proteintech Cat# 11779-1-AP; RRID:AB_3669133 DUSP6 Proteintech Cat# 26071-1-AP; RRID:AB_3669521 ANGPTL4 Proteintech Cat# 18374-1-AP; RRID:AB_2878539 NDRG1 Proteintech Cat# 26902-1-AP; RRID:AB_2880676 CD45 Abcam Cat# ab281586; RRID:AB_3697165 MCTP2 Proteintech Cat# 17578-1-AP; RRID:AB_2143118 CD3 Abcam Cat# ab16669; RRID:AB_443425 CD68 Abcam Cat# ab283654; RRID:AB_2922954 SYN Proteintech Cat# 17785-1-AP; RRID:AB_2271365 IGF1R Proteintech Cat# 20254-1-AP; RRID:AB_10667455 PPP2R2C Proteintech Cat# 12747-1-AP; RRID:AB_2170099 hCD45 BioLegend Cat# 304008; RRID:AB_314396 mCD45 BioLegend Cat# 103112; RRID:AB_312977 HLA-G Proteintech Cat# 66447-1-Ig anti-Myc-Tag Cell Signaling Technology Cat# 2278; RRID: AB_490778 anti-FLAG Cell Signaling Technology Cat# 14793; RRID: AB_2572291 anti-HA Abcam Cat #ab9110, RRID: AB_307019 Biological samples Human pancreatic cancer tissues This study N/A Patient-derived xenografts This study N/A Chemicals, peptides, and recombinant proteins PROTAC-G3 This study N/A Activin A MedChemExpress Cat# HY-P70311 MG-132 MedChemExpress Cat# HY-13259 Latrunculin A Abcam Cat# ab144290 KP-457 MedChemExpress Cat# HY-110397 Cycloheximide MedChemExpress Cat# HY-12320 (S)-ACE-OH MedChemExpress Cat# HY169325 OVA Peptide MedChemExpress Cat# HY-P1489 Recombinant Streptococcus pyogenes CRISPR-Cas9 Protein (His Tag) SinoBiological Cat: 40572-A08B (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–16.e1–e11, August 10, 2026 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays poly-L-lysine MedChemExpress Cat# HY-126437K Optimal Cutting Temperature (OCT) compound Solarbio Cat# I7830 Protease inhibitor cocktail Proteintech Cat# PR20032 HypoxyprobeTM-1 Natural Pharmacia International Cat# HP3-100Kit P3 Primary Cell 4D-Nucleofector X Unit Reagent Kit L LONZA LONZA-V4XP-3024 IFN-γ ELISpot Kit Dayo Cat#2210005 DAPI Dihydrochloride Proteintech 28718-90-3 Deposited data snRNA-seq data (human PDAC tissues) This study National Omics Data Encyclopedia, OEP00006497 RNA-seq data (cell lines) This study National Omics Data Encyclopedia, OEZ00021631 Xenium 5K data (human PDAC tissues) This study National Omics Data Encyclopedia, OEZ00021630 snRNA-seq data (human PDAC tissues with neoadjuvant treatment) Hwang et al.11 GSE202051 scRNA-seq data (human PDAC tissues, #1) Steele et al. GSE155698 scRNA-seq data (human PDAC tissues, #2) Peng et al.12 CRA001160 scRNA-seq data (human PDAC tissues, #3) Lin et al. GSE154778 Experimental models: Cell lines MIA PaCa-2 American Type Culture Collection CRL-1420 CFPAC-1 American Type Culture Collection CRL-1918 SW1990 American Type Culture Collection CRL-2172 PANC-1 American Type Culture Collection CRL-1469 αTC1-6 American Type Culture Collection CRL-2934 THP-1 American Type Culture Collection TIB-202 HUVEC American Type Culture Collection PCS-100-013 HPDE6-C7 Anwei-sci Cell Center AW-CH0777 KPC-0116 FUSCC https://doi.org/10.1016/j. xcrm.2023.101234 Patient-derived CAFs FUSCC https://doi.org/10.1016/j. csbj.2024.04.021. .. Oligonucleotides siRNA targeting human PLOD2, si#1: GGAACACUAUGCUGAUCAAtt GeneAdv N/A siRNA targeting human PLOD2, si#2: GGUCCUUGGUICAAGGAGAAtt GeneAdv N/A siRNA targeting mouse PLOD2, si#2: CGAAGGACUUCCUGUUAAATT GeneAdv N/A sg-PLOD2-1: AATGTAGAAGCATCATGATG Tsingke Biotech N/A sg-TRIM21-3 TCATCTCAGAGCTAGATCGA Tsingke Biotech N/A (Continued on next page) ll OPEN ACCESS Article e2 Cancer Cell 44, 1–16.e1–e11, August 10, 2026



    Similar Products

    primary human umbilical vein endothelial cells huvec  (ATCC)
    99
    ATCC primary human umbilical vein endothelial cells huvec
    Primary Human Umbilical Vein Endothelial Cells Huvec, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primary+umbilical+vein+endothelial+cells%3B+normal%2C+human/Primary+Umbilical+Vein+Endothelial+Cells%3B+Normal%2C+Human/pm42321469-533-0-12
    Average 99 stars, based on 1 article reviews
    primary human umbilical vein endothelial cells huvec - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    human umbilical vein  (ATCC)
    99
    ATCC human umbilical vein
    Human Umbilical Vein, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primary+umbilical+vein+endothelial+cells%3B+normal%2C+human/Primary+Umbilical+Vein+Endothelial+Cells%3B+Normal%2C+Human/pmc13156596-165-10-19
    Average 99 stars, based on 1 article reviews
    human umbilical vein - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    human umbilical vein endothelial cells  (ATCC)
    99
    ATCC human umbilical vein endothelial cells
    Human Umbilical Vein Endothelial Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primary+umbilical+vein+endothelial+cells%3B+normal%2C+human/Primary+Umbilical+Vein+Endothelial+Cells%3B+Normal%2C+Human/pm42267664-67-0-8
    Average 99 stars, based on 1 article reviews
    human umbilical vein endothelial cells - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    huvec umbilical vein endothelial cells  (ATCC)
    99
    ATCC huvec umbilical vein endothelial cells
    Huvec Umbilical Vein Endothelial Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primary+umbilical+vein+endothelial+cells%3B+normal%2C+human/Primary+Umbilical+Vein+Endothelial+Cells%3B+Normal%2C+Human/pm42276073-409-0-5
    Average 99 stars, based on 1 article reviews
    huvec umbilical vein endothelial cells - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    umbilical vein endothelial cells  (ATCC)
    99
    ATCC umbilical vein endothelial cells
    Umbilical Vein Endothelial Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primary+umbilical+vein+endothelial+cells%3B+normal%2C+human/Primary+Umbilical+Vein+Endothelial+Cells%3B+Normal%2C+Human/10__1161_slash_atvbaha__125__324258-72-10-15
    Average 99 stars, based on 1 article reviews
    umbilical vein endothelial cells - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    type culture collection tib 202 huvec american type culture collection pcs 100 013 hpde6 c7 anwei sci cell center aw ch0777 kpc 0116 fuscc  (ATCC)
    99
    ATCC type culture collection tib 202 huvec american type culture collection pcs 100 013 hpde6 c7 anwei sci cell center aw ch0777 kpc 0116 fuscc
    Type Culture Collection Tib 202 Huvec American Type Culture Collection Pcs 100 013 Hpde6 C7 Anwei Sci Cell Center Aw Ch0777 Kpc 0116 Fuscc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primary+umbilical+vein+endothelial+cells%3B+normal%2C+human/Primary+Umbilical+Vein+Endothelial+Cells%3B+Normal%2C+Human%2C+Pooled/pm42276047-732-169-174
    Average 99 stars, based on 1 article reviews
    type culture collection tib 202 huvec american type culture collection pcs 100 013 hpde6 c7 anwei sci cell center aw ch0777 kpc 0116 fuscc - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    human primary umbilical vein endothelial cells huvec  (ATCC)
    99
    ATCC human primary umbilical vein endothelial cells huvec
    Human Primary Umbilical Vein Endothelial Cells Huvec, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primary+umbilical+vein+endothelial+cells%3B+normal%2C+human/Primary+Umbilical+Vein+Endothelial+Cells%3B+Normal%2C+Human/pm42270057-69-1-15
    Average 99 stars, based on 1 article reviews
    human primary umbilical vein endothelial cells huvec - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    pcs 100 010  (ATCC)
    99
    ATCC pcs 100 010
    Pcs 100 010, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primary+umbilical+vein+endothelial+cells%3B+normal%2C+human/Primary+Umbilical+Vein+Endothelial+Cells%3B+Normal%2C+Human/pm42260132-45-10-10
    Average 99 stars, based on 1 article reviews
    pcs 100 010 - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results